Figure 2

Plasmid mediated Nk4 gene therapy of LLC tumours. (a) Nk4 plasmid expression in vitroLLC cells were transfected with pSelectBlasti-2BhIL32b by lipofection in vitro. cDNA was prepared from total RNA extracted at 24 h, and subjected to PCR with primers specific for a 300 bp Nk4 sequence (5'CCTCTCTGATGACATGAAGAAG3', 5'TGTCACAAAAGCTCTCCCC3'). Lane 1 = RNA from LLC transfected with pSelectBlasti-2BhIL32b, lane 2 = pSelectBlasti-2BhIL32b DNA, lane 3 = RNA from untransfected LLC cells, lane 4 = H₂O template control. (b) Transfection of LLC tumours in vivo In vivo luciferase activity from pCMV Luc transfected tumours was analysed. 100 μl 6 mg/ml luciferin (Biosynth, Switzerland) was injected i.p. and i.t. Mice were anaesthetised by i.p. administration of 100 μg xylazine and 1 mg ketamine. Ten minutes post-luciferin injection, mice were imaged for 1 min using an intensified CCD camera (IVIS Imaging System, Xenogen). 1.64 × 10^-8 p/sec/cm²/sr/plasmid copy was observed. (c) Tumour growth curve of LLC treated tumoursTime points of treatment and lung excision are indicated. Nk4 treated group showed reduction in tumour size compared with the other control groups, indicating Nk4 effect on tumour growth although not statistically significant. (n = 6) (d) Macroscopic LLC metastatic lung nodulesNodules appear as dark red spots on freshly excised lung, or light yellow colour on lungs fixed in Bouin's solution O/N. Cross sections show the morphological appearance of tumours on the inside of the lungs. Lungs were harvested from mice at day 21 post tumour induction. (e) Average volume of lung metastasesThe Nk4 group exhibited a significant reduction in metastatic burden compared with control groups (n = 3). Significant difference was observed in the volume of metastases between the Nk4 treated group compared with both the untreated group (p = 0.004), and the backbone group (p = 0.029). No statistical difference was observed between backbone and untreated groups (p = 0.587).