Skip to main content

Advertisement

Table 1 shRNA target sites and the efficiency of CCR5 reduction in MAGI-CCR5 cells

From: Characterization of a potent non-cytotoxic shRNA directed to the HIV-1 co-receptor CCR5

Target region Target sequence Nucleotide position CCR5 reduction on MAGI-CCR5
CCR5-1 aagtgtcaagtccaatctatgac 13 +++
CCR5-2 aagagcatgactgacatctacct 186 ++
CCR5-3 ctgacaatcgataggtacctggc 366 -
CCR5-4 gtgacaagtgtgatcacttgggt 442 -
CCR5-5 ttgtcatggtcatctgctactgg 624 ++
CCR5-6 cagtagctctaacaggttggaca 809 +
CCR5-7 aaggtcttcattacacctgcagc 517 +/-
CCR5-8 aagttcagaaactacctcttagt 909 +++
  1. Eight shRNAs against human CCR5 were selected by a published algorithm[7]. shRNA target sequences are shown in the second column. Corresponding nucleotide positions of the target sequence in CCR5 mRNA are shown in the 3rd column. MAGI-CCR5 cells were transduced with lentiviral vectors expressing shRNA under the U6 promoter. To determine the expression levels of CCR5 on cell surface, the cells were cultured for 4 days and stained with APC conjugated anti-human CCR5 monoclonal antibody. The reduction levels of in EGFP+ population was analyzed by flow cytometry and shown as following criteria (+++ more than 10 fold reduction, ++ 10 fold reduction, + 3–5 fold reduction, +/- 2 fold reduction, – no reduction).