Characterization of a potent non-cytotoxic shRNA directed to the HIV-1 co-receptor CCR5

Table 1 shRNA target sites and the efficiency of CCR5 reduction in MAGI-CCR5 cells

Target region	Target sequence	Nucleotide position	CCR5 reduction on MAGI-CCR5
CCR5-1	aagtgtcaagtccaatctatgac	13	+++
CCR5-2	aagagcatgactgacatctacct	186	++
CCR5-3	ctgacaatcgataggtacctggc	366	-
CCR5-4	gtgacaagtgtgatcacttgggt	442	-
CCR5-5	ttgtcatggtcatctgctactgg	624	++
CCR5-6	cagtagctctaacaggttggaca	809	+
CCR5-7	aaggtcttcattacacctgcagc	517	+/-
CCR5-8	aagttcagaaactacctcttagt	909	+++

Eight shRNAs against human CCR5 were selected by a published algorithm[7]. shRNA target sequences are shown in the second column. Corresponding nucleotide positions of the target sequence in CCR5 mRNA are shown in the 3^rd column. MAGI-CCR5 cells were transduced with lentiviral vectors expressing shRNA under the U6 promoter. To determine the expression levels of CCR5 on cell surface, the cells were cultured for 4 days and stained with APC conjugated anti-human CCR5 monoclonal antibody. The reduction levels of in EGFP+ population was analyzed by flow cytometry and shown as following criteria (+++ more than 10 fold reduction, ++ 10 fold reduction, + 3–5 fold reduction, +/- 2 fold reduction, – no reduction).