Skip to main content

Table 2 Multiple domain, single transcript sequences

From: A comparison of multiple shRNA expression methods for combinatorial RNAi

Comb. Sequence a Len.
R_V_T 1 GGAACUUAAGAGUGAAGCUGUUAGACAUUACUCGAGAAAUGUCUAACAGCUUCACUCUUAAGUUCCGUAUAUUUCAAGGAAAGCUAAGGACUGGUUACUCGAGAAACCAGUCCUUAGCUUUCCUUGAAAUAUAGAAACUGCUUGUACCAAUUGCUAUUGUAAAACUCGAGAUUUACAAUAGCAAUUGGUACAAGCAGUUUGUx 204
R_V_T 8 GGAACUUAAGAGUGAAGCUGUUAGACAUUACUCGAGAAAUGUCUAACAGCUUCACUCUUAAGUUCCGCUGCAGGUAUAUUUCAAGGAAAGCUAAGGACUGGUUACUCGAGAAACCAGUCCUUAGCUUUCCUUGAAAUAUAGGACGUCGAAACUGCUUGUACCAAUUGCUAUUGUAAAACUCGAGAUUUACAAUAGCAAUUGGUACAAGCAGUUUGUx 218
V-T GUAUAUUUCAAGGAAAGCUAAGGACUGGUUGCUGCAGGAAACUGCUUGUACCAAUUGCUAUUGUAAAACUCGAGAUUUACAAUAGCAAUUGGUACAAGCAGUUUGGACGUCGAACCAGUCCUUAGCUUUCCUUGAAAUAUAUx 144
O'-O" AAGACAGUCCAACACACGCCACCUGUCUCGCUGCAGGAACAGUCUGUCAAA
GGUGACCCCUGUCUCACUCGAGAGAGACAGGGGUCACCUUUGACAGACUGUUGGACGUCGGAGACAGGUGGCGUGUGUUGGACUGUCUUGUx
144
T-V GAAACUGCUUGUACCAAUUGCUAUUGUAAAGCUGCAGGUAUAUUUCAAGGAAAGCUAAGGACUGGUUACUCGAGAAACCAGUCCUUAGCUUUCCUUGAAAUAUAGGACGUCGUUUACAAUAGCAAUUGGUACAAGCAGUUUGUx 145
U-R GGCAAUGAGAGUGAAGGAGAAGUAUCAGCAGCUGCAGGGGAACUUAAGAGUGAAGCUGUUAGACAUUACUCGAGAAAUGUCUAACAGCUUCACUCUUAAGUUCCGGACGUCGUGCUGAUACUUCUCCUUCACUCUCAUUGCGUx 145
R-U GGGAACUUAAGAGUGAAGCUGUUAGACAUUGCUGCAGGGCAAUGAGAGUGAAGGAGAAGUAUCAGCAACUCGAGAUGCUGAUACUUCUCCUUCACUCUCAUUGCGGACGUCGAAUGUCUAACAGCUUCACUCUUAAGUUCCGUx 145
R-V-T GGAACUUAAGAGUGAAGCUGUUAGACAUUGCUGCAGGUAUAUUUCAAGGAAAGCUAAGGACUGGUUGCUGCAGGAAACUGCUUGUACCAAUUGCUAUUGUAAAACUCGAGAUUUACAAUAGCAAUUGGUACAAGCAGUUUGGACGUCGAACCAGUCCUUAGCUUUCCUUGAAAUAUAGGACGUCGAAUGUCUAACAGCUUCACUCUUAAGUUCCUx 217
T-V-R AAACUGCUUGUACCAAUUGCUAUUGUAAAGCUGCAGGUAUAUUUCAAGGAAAGCUAAGGACUGGUUGCUGCAGGGGAACUUAAGAGUGAAGCUGUUAGACAUUACUCGAGAAAUGUCUAACAGCUUCACUCUUAAGUUCCGGACGUCGAACCAGUCCUUAGCUUUCCUUGAAAUAUAGGACGUCGUUUACAAUAGCAAUUGGUACAAGCAGUUUUx 217
V-T 0 GUAUAUUUCAAGGAAAGCUAAGGACUGGUUAAACUGCUUGUACCAAUUGCUAUUGUAAAACUCGAGAUUUACAAUAGCAAUUGGUACAAGCAGUUUAACCAGUCCUUAGCUUUCCUUGAAAUAUAUx 128
V 19 - T 19 GGGAAAGCUAAGGACUGGUUGCUGCAGGCUGCUUGUACCAAUUGCUAUACUCGAGAAUAGCAAUUGGUACAAGCAGGGACGUCGAACCAGUCCUUAGCUUUCCUx 106
  1. a : sequences external to the target-matched dsRNA domains are shown in bold (e.g. loops, spacers, Ux termination remnants).